View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19175_high_142 (Length: 205)
Name: NF19175_high_142
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19175_high_142 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 49; Significance: 3e-19; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 67
Target Start/End: Complemental strand, 51695793 - 51695745
Alignment:
| Q |
19 |
agaaaggtgagtaatagtagttattctagtttctatttaaatgaccaac |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51695793 |
agaaaggtgagtaatagtagttattctagtttctatttaaatgaccaac |
51695745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 142 - 188
Target Start/End: Complemental strand, 51695716 - 51695669
Alignment:
| Q |
142 |
tcaaaaaatataatgac-tctctgtcaaatttagcttaatatcattgt |
188 |
Q |
| |
|
||||| |||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
51695716 |
tcaaataatataatcacctctctgtcaaatttagcttaatatcattgt |
51695669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University