View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19175_high_44 (Length: 432)
Name: NF19175_high_44
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19175_high_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 10 - 165
Target Start/End: Original strand, 55077299 - 55077454
Alignment:
| Q |
10 |
attattctggctattgcacttgctatgacggttgttatcaccaaggcagcggaacatgaacgccgtgtcagccccggtggaacaacactgccttctggcc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55077299 |
attattctggctattgcacttgctatgacggttgttatcaccaaggcagcggaacatgaacgccgtgtcagccccggtggaacaacactgccttctggcc |
55077398 |
T |
 |
| Q |
110 |
atgttaagactgctgcattcagtttcttcggcgtccttggaattccccttgcggta |
165 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55077399 |
atgttaaggctgctgcattcagtttcttcggcgtccttggaattccccttgcggta |
55077454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 86; Significance: 6e-41; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 258 - 355
Target Start/End: Original strand, 30033441 - 30033538
Alignment:
| Q |
258 |
aaaatgatgtttagtacggaaaacagcgtacgaaatttgaagaatgacgtggcaaagtttttgaattagtctactcttaactaaaatccaaattgtaa |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30033441 |
aaaatgatgtttagtacggaaaacagcgtacgaaatttgaagaatgacgtagcaaagcttttgaattagtctgctcttaactaaaatccaaattgtaa |
30033538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 378 - 415
Target Start/End: Original strand, 30033556 - 30033593
Alignment:
| Q |
378 |
tccaaatctaagtatacagtacaccatatcctcctacc |
415 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
30033556 |
tccaaatataaatatacagtacaccatatcctcctacc |
30033593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 76; Significance: 5e-35; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 258 - 357
Target Start/End: Complemental strand, 23147809 - 23147710
Alignment:
| Q |
258 |
aaaatgatgtttagtacggaaaacagcgtacgaaatttgaagaatgacgtggcaaagtttttgaattagtctactcttaactaaaatccaaattgtaaca |
357 |
Q |
| |
|
|||||| ||||||||||| |||||||| ||||||||||||||||||||||| ||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23147809 |
aaaatgttgtttagtacgaaaaacagcttacgaaatttgaagaatgacgtgacaaagcttttgaattagtcaactcttaactaaaatccaaattgtaaca |
23147710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 378 - 415
Target Start/End: Complemental strand, 23147693 - 23147656
Alignment:
| Q |
378 |
tccaaatctaagtatacagtacaccatatcctcctacc |
415 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
23147693 |
tccaaatctaagtatacggtacaccatatcctcctacc |
23147656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University