View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19175_high_81 (Length: 312)
Name: NF19175_high_81
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19175_high_81 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 13 - 296
Target Start/End: Complemental strand, 37845208 - 37844925
Alignment:
| Q |
13 |
aaaattgcagctaaactagtttgtcaattggcaaggttttccaacgtgcttaccaaaggagcaggtcctctcacaactcttccttggtcattgtactgag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37845208 |
aaaattgcagctaaactagtttgtcaattggcaaggttttccaacgtgcttaccaaaggagcaggtcctctcacaactcttccttggtcattgtactgag |
37845109 |
T |
|
| Q |
113 |
atccatggcaggggcagatgaacttcttctcagcttgattaaatggcacgacacacccgaggtgagtgcatacggcattaattgcaaatgttgcaagtgt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37845108 |
atccatggcaggggcagatgaacttcttctcagcttgattaaatggcacgacacacccgaggtgagtgcatacggcattaattgcaaatgttgcaagtgt |
37845009 |
T |
|
| Q |
213 |
tctgtcactctctaccacaagataggtaggatcaccctgttattgaatttatcaaagtagttattatggtggaagcttgagaag |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37845008 |
tctgtcactctctaccacaagataggtaggatcaccctgttattgaatttatcaaagtagttattatggtggaagcttgagaag |
37844925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University