View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19175_high_82 (Length: 311)
Name: NF19175_high_82
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19175_high_82 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 258; Significance: 1e-144; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 14 - 287
Target Start/End: Original strand, 26414953 - 26415226
Alignment:
| Q |
14 |
tacttttgaaattataccattgtaaattatattgccatgagaaaatgaatactcaggcactgttttatgtgtttacattttctacttttgaaattgtact |
113 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26414953 |
tacttttgaaattgtaccattgtaaattatattgccatgagaaaatgaatactcaggcactgttttatgtgtttacattttctacttttgaaattgtact |
26415052 |
T |
 |
| Q |
114 |
attgtggatggtattgccattagaaatgaatattcatacactattttaaattttacaaagtgtatggtttgatttgaaaactccttgcctagaaattatt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26415053 |
attgtggatggtattgccattagaaatgaatattcatagactattttaaattttacaaagtgtatggtttgatttgaaaactccttgcctagaaattatt |
26415152 |
T |
 |
| Q |
214 |
tataaaatcctgcatttgattcaaattgttggcgggtaaatgttttcgaaagaagctagatgcgtatcaaattg |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26415153 |
tataaaatcctgcatttgattcaaattgttggctggtaaatgttttcgaaagaagctagatgcatatcaaattg |
26415226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 79 - 139
Target Start/End: Original strand, 26414936 - 26414996
Alignment:
| Q |
79 |
tatgtgtttacattttctacttttgaaattgtactattgtggatggtattgccattagaaa |
139 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||| ||||| || ||||||||| ||||| |
|
|
| T |
26414936 |
tatgtgtgtacatattctacttttgaaattgtaccattgtaaattatattgccatgagaaa |
26414996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University