View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19175_high_91 (Length: 281)
Name: NF19175_high_91
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19175_high_91 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 14 - 262
Target Start/End: Complemental strand, 8393571 - 8393328
Alignment:
| Q |
14 |
agaagacacatgtaaactaataagatcacacccatgcctatgcaaggcaggaatagtgccatcagtattgcatctaacatctccagtttgttttc-ttga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8393571 |
agaagacacatgtaaactaataagatcacacccatgcctatgcaaggcaggaatagtgccatcagtattgcatctaacatctccagtttgttttctttga |
8393472 |
T |
|
| Q |
113 |
tatattgctgaatgaatgaatcaatgaggtttttggattgttattgttattgttatatgttaggttgtgaataaattaagttttgtttattgagtgtgga |
212 |
Q |
| |
|
|||||||| |||| ||| ||| ||| |||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8393471 |
tatattgcagaatcaatcaatgaatcaggtttttgg------attgttattgttatattttaggttgtgaataaattaagttttgtttattgagtgtgga |
8393378 |
T |
|
| Q |
213 |
gaagaaaagagatggtgtggtatggtatggtatgggaaatgggaatcatt |
262 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8393377 |
gaagaaaagagagggtgtggtatggtatggtatgggaaatgggaatcatt |
8393328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University