View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19175_low_104 (Length: 268)
Name: NF19175_low_104
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19175_low_104 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 40 - 268
Target Start/End: Original strand, 14811761 - 14811989
Alignment:
| Q |
40 |
atcatctttatatcccttgctctacaagaaaaaatcactatccttttttaaaatatttgacttcaagttcaagccgttattagcaaggaacttcatttct |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14811761 |
atcatctttatatcccttgctctacaagaaaaaatcactatcctttttaaaaatatttgacttcaagttcaagccgttattagcaaggaacttca-ttct |
14811859 |
T |
|
| Q |
140 |
ttcattctcgaagcccgaaggtgagaagaaacctcccccgcgtgaatagtttgaacacacaaaacgtgtgaatctattc--aaaaaaggaaaatcccnnn |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14811860 |
ttcattctcgaagcccgaaggtgagaagaaacctcccccgcgtgaatagtttgaacacacaaaacgtgtgaatctattcaaaaaaaaggaaaatccc-ct |
14811958 |
T |
|
| Q |
238 |
nnnnnncactagaagaccaaatgaaaaatca |
268 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
14811959 |
ttttttcactagaagaccaaatgaaaaatca |
14811989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University