View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19175_low_106 (Length: 264)
Name: NF19175_low_106
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19175_low_106 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 12 - 102
Target Start/End: Complemental strand, 41232274 - 41232184
Alignment:
| Q |
12 |
acaacatataaccaaacgaagcattagtggaatggaatgaattctctcaattgttttcctctgaatcatagtgaattttattattgaatgg |
102 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
41232274 |
acaacatataaccaaaggaagcattagtggaatggaatgaattctctcaattgttttcctctcaatcatagtcaattttattattgaatgg |
41232184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 191 - 246
Target Start/End: Complemental strand, 41232095 - 41232040
Alignment:
| Q |
191 |
gaaagaattgaaaggatccaatgaatccccaaatttagcttctaaatgcttatctt |
246 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41232095 |
gaaacaattgaaaggatccaatgaatccccaaatttagcttctaaatgcttatctt |
41232040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University