View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19175_low_109 (Length: 261)
Name: NF19175_low_109
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19175_low_109 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 17 - 261
Target Start/End: Complemental strand, 53054965 - 53054702
Alignment:
| Q |
17 |
acagatctcgaccatcatatcaaaatcaatggtcaagaccattgaaaacaaattatataaacgt-------------------ctcgaatcaatggttga |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
53054965 |
acagatctcgaccatcatatcaaaatcaatggtcaagaccattgaaaacaaattatataaacgtgtaatttaaacagttcaatctcgaatcaatggttga |
53054866 |
T |
 |
| Q |
98 |
gattgactactccatataactgcgtgcttttattaatgcagagaatccaaatccgaaccggacattgatgccataacagtactactactttttctagttg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53054865 |
gattgactactccatataactgcgtgcttttattaatgcagagaatccaaatccgaaccggacattgatggcataacagtactactactttttctagttg |
53054766 |
T |
 |
| Q |
198 |
ggcctggtgcaatcaaacctaatttcaccttgattaccagttttaacaccaacccttcccaact |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53054765 |
ggcctggtgcaatcaaacctaatttcaccttgattaccagttttaacaccaacccttcccaact |
53054702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University