View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19175_low_113 (Length: 251)
Name: NF19175_low_113
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19175_low_113 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 19 - 244
Target Start/End: Original strand, 36423328 - 36423553
Alignment:
| Q |
19 |
ttaactgtgttggttgatatggataagagagaggttgtgtccattacagataatggactaaacattcctgtcgcaaatggtatcgacactgattaccgtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36423328 |
ttaactgtgttggttgatatggataagagagaggttgtgtccattacagataatggactaaacattcctgtcgcaaatggtatcgacactgattaccgtt |
36423427 |
T |
 |
| Q |
119 |
actcagttcagaaactcaacggagagttgaacttgataaatccaatttccttggaacaaccaaaaggtccaagctttacagttgatggacatttggtgaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36423428 |
actcagttcagaaactcaacggagagttgaacttgataaatccaatttccttggaacaaccaaaaggtccaagctttacagttgatggacatttggtgaa |
36423527 |
T |
 |
| Q |
219 |
atgggctaattgggaatttcatctca |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
36423528 |
atgggctaattgggaatttcatctca |
36423553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University