View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19175_low_114 (Length: 251)

Name: NF19175_low_114
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19175_low_114
NF19175_low_114
[»] chr5 (2 HSPs)
chr5 (137-235)||(36259719-36259817)
chr5 (73-123)||(36259944-36259994)


Alignment Details
Target: chr5 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 137 - 235
Target Start/End: Complemental strand, 36259817 - 36259719
Alignment:
137 taaaaattacaaatagttgaatagtagtgcagtgccacattgtgggttttaacgtaaaatcactatgggtagggtaaagcatattacttgaaataaatc 235  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
36259817 taaaaattacaaatagttgaatagtagtgcagtgccacattgtgggttttaacgtaaaatcactataggtagggtaaagcatattacttgaaataaatc 36259719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 73 - 123
Target Start/End: Complemental strand, 36259994 - 36259944
Alignment:
73 tacatcaattctatagaattatggcatttgagataagagagcttcaatttt 123  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
36259994 tacatcaattctatagaattatggcatttgagataagagagcttcaatttt 36259944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University