View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19175_low_116 (Length: 250)
Name: NF19175_low_116
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19175_low_116 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 13 - 233
Target Start/End: Complemental strand, 4400853 - 4400633
Alignment:
| Q |
13 |
cactctcactttaaacaaatagatccaaaattgaccannnnnnnn-gccaataaaattgaccatttatttctgaacttttaatttcatgtctaattacta |
111 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4400853 |
cactcccactttaaacaaatagatccaaaattgaccattgttttttgccaataaaattgaccattt----ctgaacttttaatttcatgtctaattacta |
4400758 |
T |
 |
| Q |
112 |
---gaaaagcctaacaatcaagaaatccatttcaataatatgcaaccaaattaaaccgcttgttattataatcatgtttacaaactacacaaacttaact |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4400757 |
ctagaaaagcctaacaatcaagaaatccatttcaataatatgcaaccaaattaaaccgcttgttattataatcatgtttacaaactacacaaacttaact |
4400658 |
T |
 |
| Q |
209 |
gatatcaaaatcaaatgcctcaact |
233 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
4400657 |
gatatcaaaatcaaatgcctcaact |
4400633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University