View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19175_low_131 (Length: 238)
Name: NF19175_low_131
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19175_low_131 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 17 - 238
Target Start/End: Complemental strand, 36423952 - 36423731
Alignment:
| Q |
17 |
aataagacagtgattatgtcatgagtactgaaattattaccttaatgtcagtgattggacactcggcgtgtcgccaagcaatgtcaccagcataactctc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36423952 |
aataagacagtgattatgtcatgagtactgaaattattaccttaatgtcagtgattggacactcggcgtgtcgccaagcaatgtcaccagcataactctc |
36423853 |
T |
|
| Q |
117 |
aaaaatgcaaatcatgtttggttgaacatatggtgttccatcagcagaagtaaacactccatccatgtagtaagcattccttggacaatcatttaaaggg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36423852 |
aaaaatgcaaatcatgtttggttgaacatatggtgttccatcagcagaagtaaacactccatccatgtagtaagcatttcttggacaatcatttaaaggg |
36423753 |
T |
|
| Q |
217 |
tctaaaggcattgcttgcaaac |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
36423752 |
tctaaaggcattgcttgcaaac |
36423731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 94 - 132
Target Start/End: Complemental strand, 20538310 - 20538272
Alignment:
| Q |
94 |
gcaatgtcaccagcataactctcaaaaatgcaaatcatg |
132 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
20538310 |
gcaacgtcaccagcataactctcaaaaatgcaaatcatg |
20538272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University