View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19175_low_133 (Length: 236)
Name: NF19175_low_133
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19175_low_133 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 94 - 222
Target Start/End: Original strand, 39525881 - 39526009
Alignment:
| Q |
94 |
ttcttcaaatgagaagctcttttgagtatattttttaaaaattaattagtgcaatattaatttttaaaacaacatgtaaatagaaacaatttcttttgta |
193 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39525881 |
ttctttaaatgagaagctcttttgagtatattttttaaaaattaattagtgcaatattaatttttaaaacaacatgtaaatagaaacaatttcttttgta |
39525980 |
T |
 |
| Q |
194 |
aaataaaacagaaatgagataatgattct |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39525981 |
aaataaaacagaaatgagataatgattct |
39526009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University