View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19175_low_135 (Length: 235)
Name: NF19175_low_135
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19175_low_135 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 14 - 232
Target Start/End: Complemental strand, 18914543 - 18914325
Alignment:
| Q |
14 |
aaaagttactagtgtaccattgtcgcaaaattgatgcacttaaataaatttactcggttgcataagttagaacaaattttcctttctcaccaaagagtcg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
18914543 |
aaaagttactagtgtaccattgtcgcaaaattgatgcacttaaataaatttactcggttgcataagttggaacaaattttcctttctcaccaaagagtcg |
18914444 |
T |
 |
| Q |
114 |
ttgcattcatcagtgatcttaagtcagacatttggtaaagaggatctcagttcagaggcttgaactacaaagtgttgacttccataaaacannnnnnnna |
213 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || | |
|
|
| T |
18914443 |
ttgcattcatcagtgatcttaagtcagacgcttggtaaagaggatctcagttcagaggcttgaactataaagtgttgacttccataaagcatttttttta |
18914344 |
T |
 |
| Q |
214 |
tatatgacacaaaacttca |
232 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
18914343 |
tatatgacacaaaacttca |
18914325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University