View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19175_low_136 (Length: 229)

Name: NF19175_low_136
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19175_low_136
NF19175_low_136
[»] chr6 (2 HSPs)
chr6 (1-88)||(18237609-18237696)
chr6 (162-213)||(18237770-18237821)


Alignment Details
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 18237609 - 18237696
Alignment:
1 tgaaattttattagacgtcgtctcaaatccactttacaccgacgatagatatcctttaaatcgaaaaaacatatcatattttatgtct 88  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| | ||||| ||||||||||    
18237609 tgaaattttattagacgtcgtctcaaatccactttacaccgatgatagatatcctttatatcgaaaaaaaacatcattttttatgtct 18237696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 162 - 213
Target Start/End: Original strand, 18237770 - 18237821
Alignment:
162 ctttcatcaaatcaaacatatgcatgtatgtccttaagtatgtccaaaatat 213  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||    
18237770 ctttcatcaaatcaaacatatgcatgtatatccttaagtatgtccaaaatat 18237821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University