View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19175_low_136 (Length: 229)
Name: NF19175_low_136
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19175_low_136 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 18237609 - 18237696
Alignment:
| Q |
1 |
tgaaattttattagacgtcgtctcaaatccactttacaccgacgatagatatcctttaaatcgaaaaaacatatcatattttatgtct |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| | ||||| |||||||||| |
|
|
| T |
18237609 |
tgaaattttattagacgtcgtctcaaatccactttacaccgatgatagatatcctttatatcgaaaaaaaacatcattttttatgtct |
18237696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 162 - 213
Target Start/End: Original strand, 18237770 - 18237821
Alignment:
| Q |
162 |
ctttcatcaaatcaaacatatgcatgtatgtccttaagtatgtccaaaatat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18237770 |
ctttcatcaaatcaaacatatgcatgtatatccttaagtatgtccaaaatat |
18237821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University