View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19175_low_138 (Length: 227)
Name: NF19175_low_138
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19175_low_138 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 14 - 209
Target Start/End: Original strand, 11353799 - 11353994
Alignment:
| Q |
14 |
atgaaacatcaagaaaattaagggtgcacaaggtgagtgagtggactaagctgtggggactataaattctgcaaaaatgcaagttgtttgtttcaaggtt |
113 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11353799 |
atgaaacatcacgaaaattaagggtgcacaaggcgagtgagtggactaatctgtggggactataaattctgcaaaaatgcaagttgtttgtttcaaggtt |
11353898 |
T |
|
| Q |
114 |
ggcttgggtgtctgccccaacatgagaaagattgcattataaaggtgtcccatgacctcttgtctgccagaaatcgagctcacatggaggctgttt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11353899 |
ggcttgggtgtctgccccaacatgagaaagattgtattataaaggtgtcccatgacctcttgtctgccagaaatcgagctcacatggaggctgttt |
11353994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University