View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19175_low_140 (Length: 217)
Name: NF19175_low_140
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19175_low_140 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 15 - 201
Target Start/End: Original strand, 4202510 - 4202695
Alignment:
| Q |
15 |
aatactaatgtgacaatgaatataaaaaacatatagtctatgtttagtattacaaatgaatgtcagaatcacggtaacccacttgannnnnnnaatagcg |
114 |
Q |
| |
|
||||||||||||||| |||||||||| |||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||| || |||| |
|
|
| T |
4202510 |
aatactaatgtgacatcaaatataaaaa-catagagtctatgtttggtattacaaatgaatgtcagaattacggtaacccacttgatttttttaaaagcg |
4202608 |
T |
|
| Q |
115 |
ggtcatcgagactcaatagcttttgcaaaatcacgacaggttatcgaattctactatatacatcgtgataccaaacatacacatagt |
201 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4202609 |
ggtcatccagactcaatagcttctgcaaaatcacgacagatcatcgaattctactatatacatcgtgataccaaacatacacatagt |
4202695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University