View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19175_low_44 (Length: 432)

Name: NF19175_low_44
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19175_low_44
NF19175_low_44
[»] chr4 (1 HSPs)
chr4 (10-165)||(55077299-55077454)
[»] chr3 (2 HSPs)
chr3 (258-355)||(30033441-30033538)
chr3 (378-415)||(30033556-30033593)
[»] chr8 (2 HSPs)
chr8 (258-357)||(23147710-23147809)
chr8 (378-415)||(23147656-23147693)


Alignment Details
Target: chr4 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 10 - 165
Target Start/End: Original strand, 55077299 - 55077454
Alignment:
10 attattctggctattgcacttgctatgacggttgttatcaccaaggcagcggaacatgaacgccgtgtcagccccggtggaacaacactgccttctggcc 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55077299 attattctggctattgcacttgctatgacggttgttatcaccaaggcagcggaacatgaacgccgtgtcagccccggtggaacaacactgccttctggcc 55077398  T
110 atgttaagactgctgcattcagtttcttcggcgtccttggaattccccttgcggta 165  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
55077399 atgttaaggctgctgcattcagtttcttcggcgtccttggaattccccttgcggta 55077454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 86; Significance: 6e-41; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 258 - 355
Target Start/End: Original strand, 30033441 - 30033538
Alignment:
258 aaaatgatgtttagtacggaaaacagcgtacgaaatttgaagaatgacgtggcaaagtttttgaattagtctactcttaactaaaatccaaattgtaa 355  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |||||||||||||||||||||||||    
30033441 aaaatgatgtttagtacggaaaacagcgtacgaaatttgaagaatgacgtagcaaagcttttgaattagtctgctcttaactaaaatccaaattgtaa 30033538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 378 - 415
Target Start/End: Original strand, 30033556 - 30033593
Alignment:
378 tccaaatctaagtatacagtacaccatatcctcctacc 415  Q
    ||||||| ||| ||||||||||||||||||||||||||    
30033556 tccaaatataaatatacagtacaccatatcctcctacc 30033593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 76; Significance: 5e-35; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 258 - 357
Target Start/End: Complemental strand, 23147809 - 23147710
Alignment:
258 aaaatgatgtttagtacggaaaacagcgtacgaaatttgaagaatgacgtggcaaagtttttgaattagtctactcttaactaaaatccaaattgtaaca 357  Q
    |||||| ||||||||||| |||||||| ||||||||||||||||||||||| ||||| ||||||||||||| ||||||||||||||||||||||||||||    
23147809 aaaatgttgtttagtacgaaaaacagcttacgaaatttgaagaatgacgtgacaaagcttttgaattagtcaactcttaactaaaatccaaattgtaaca 23147710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 378 - 415
Target Start/End: Complemental strand, 23147693 - 23147656
Alignment:
378 tccaaatctaagtatacagtacaccatatcctcctacc 415  Q
    ||||||||||||||||| ||||||||||||||||||||    
23147693 tccaaatctaagtatacggtacaccatatcctcctacc 23147656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University