View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19175_low_53 (Length: 410)
Name: NF19175_low_53
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19175_low_53 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 16 - 392
Target Start/End: Complemental strand, 51694266 - 51693890
Alignment:
| Q |
16 |
agtagcatgaaaaagatgtaggggtagcatgtattgtttgaacctaaaatatttggagacaaaaattcttacactaacatgggctcattcatcactcgtg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51694266 |
agtagcatgaaaaagatgtaggggtagcatgtattgtttgaacctaaaatatttggagacaaaaattcttacactaacatgggctcattcatcactcgtg |
51694167 |
T |
 |
| Q |
116 |
caagaggggtgaaagggccctctataaggccgaatccgattcacatacccattacccatgtgccctagttttttgtctgaaaccgctgacttttgaaaag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51694166 |
caagaggggtgaaagggccctctataaggccgaatccgattcacatacccattacccatgtgccctagttttttgtctgaaaccgctgacttttgaaaag |
51694067 |
T |
 |
| Q |
216 |
acacatataacctcattattgacatgacacaaacaaaatcaatactcaaaattttgtgcatggtgcagtgactggttgggagcatctccaccaaaacccg |
315 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
51694066 |
acacatataacctcattattgtcatgacacaaacaaaatcaatactcaaaattttgtgtatggtgtagtgactggttgggagcatctccaccaaaacccg |
51693967 |
T |
 |
| Q |
316 |
taaattacggccctctctcaaatacgttatctactttcgtcgttttcggttcttacaagtcactttcttgtctctac |
392 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
51693966 |
taaattacggccctctctcaaatacgttatctactttcgtcgttttcggttcttacaagtcactatcttgtccctac |
51693890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University