View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19175_low_96 (Length: 275)
Name: NF19175_low_96
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19175_low_96 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 266
Target Start/End: Original strand, 3900502 - 3900750
Alignment:
| Q |
17 |
acaaaataacatagagtcaaaaaaggctcagttaatttgggatggaaagaatactatatttgatatgagatattgactcgtataaatcagaaaaggtcaa |
116 |
Q |
| |
|
||||||||||| | |||||| || |||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3900502 |
acaaaataacaaa-agtcaagaatggctcagttaatttgggatggaaagagtactatatttgatatgagatattgactcatataaatcagaaaaggtcaa |
3900600 |
T |
|
| Q |
117 |
acattctctaagtgaggaaatgaaatagcaacgtaacactttggttttgctcaacctaacatcatattctcacaattactttctaggagaaatcttcgac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3900601 |
acattctctaagtgaggaaatgaaatagcaacataacactttggttttgctcaacctagcatcatattctcacaattactttctaggagaaatcttcgac |
3900700 |
T |
|
| Q |
217 |
aatagatatcacttgaaaaacgtaatcccattatcgactatgctctctgc |
266 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3900701 |
aatagatatctcttgaaaaacgtaatcccattatcgaccatgctctctgc |
3900750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University