View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19175_low_97 (Length: 275)
Name: NF19175_low_97
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19175_low_97 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 11 - 256
Target Start/End: Original strand, 14812285 - 14812530
Alignment:
| Q |
11 |
agaagaagaagatgaagatgatgatgagtttacatttgttttcgcagatcctaaaggttcaccgatttccgctgacgatgtgttcgataaaggtcagatt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14812285 |
agaagaagaagatgaagatgatgatgagtttacatttgttttcgcagatcctaaaggttcaccgatttccgctgacgatgtgttcgataaaggtcagatt |
14812384 |
T |
 |
| Q |
111 |
cgtccgannnnnnnnnnnnncggtcaggatcttcatttcaccgacgattacgataatgaatctggaaaccgttcaccggtgaggaaatttttcgtcgaat |
210 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14812385 |
cgtccgatttttccttttttcggtcaggatcttcatttcaccgacgattacgataatgaatctggaaaccgttcaccggtgaggaaatttttcgtggaat |
14812484 |
T |
 |
| Q |
211 |
caccgtcttcgtcgaagacagcgacgagttctgcggcggtggaagg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14812485 |
caccgtcttcgtcgaagacagcgacgagttctgcggcggtggaagg |
14812530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University