View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19175_low_99 (Length: 273)
Name: NF19175_low_99
Description: NF19175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19175_low_99 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 263
Target Start/End: Original strand, 20479367 - 20479615
Alignment:
| Q |
18 |
aacaccatcttcatcctctgtgctagagtttgacccttctt---ttgagtcgnnnnnnncttcttatgatttcccattatgtgtgatgcgattgcgagag |
114 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
20479367 |
aacaccatcttcatcctctgtgctagactttgacccttcttcttttgagtcgtttttttcttcttatgatttcccattatgtgcgatgcgattgcgagag |
20479466 |
T |
 |
| Q |
115 |
tggaactatggaaagaagagaagatcgctagctagggttttgagagttatctatcttgttttatgctaaataagggtttcgtttccaatttatatcttcg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20479467 |
tggaactatggaaagaagagaagatcgctagctagggttttgagagttatctatcttgttttatgctaaataagggtttcgtttccaatttatatcttcg |
20479566 |
T |
 |
| Q |
215 |
gttgtagcaaaccctaacttcaattccaataaactatttttcacctatg |
263 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
20479567 |
gttgtagcaaaccctaccttcaattccaataaactatttttcatctatg |
20479615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University