View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19176_low_10 (Length: 438)
Name: NF19176_low_10
Description: NF19176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19176_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 1 - 321
Target Start/End: Complemental strand, 27701633 - 27701313
Alignment:
| Q |
1 |
ccaccattgctgccacctccattgctgagtgaggagaatttgaaggttttgattgaaaaagaatgtcatcacttgcctgctagtgattatgtcaataggc |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27701633 |
ccaccattgttgccacctccattgctgagtgaggagaatttgaaggttttgattgaaaaagaatgtcatcacttgcctgctagtgattatgtcaataggc |
27701534 |
T |
 |
| Q |
101 |
tgaaaaatggtgaattggatttgcagggcaggatggaatccattgattggatggaaaaggtggggtccacatttatttgattcttaatttctcattaatt |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27701533 |
tgaaaaatggagaattggatttgcagggcaggatggaatccattgattggatggaaaaggtggggtccacatttatttgattcttaatttctcattaatt |
27701434 |
T |
 |
| Q |
201 |
tttagggtttcaactatatgtgagttcattttctcttttgctagttccaatgttatgtacattgtttttctttaatctcnnnnnnnattgacaattaata |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||| |
|
|
| T |
27701433 |
tttagggtttcaactatatgtgagttcattttctcttttgctagttccaatgttatgtgcattgtttttctttaatctctttttttattgaaaattaata |
27701334 |
T |
 |
| Q |
301 |
ttctttaatcttggcatgtga |
321 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
27701333 |
ttctttaatcttggcatgtga |
27701313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University