View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19176_low_38 (Length: 222)
Name: NF19176_low_38
Description: NF19176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19176_low_38 |
 |  |
|
| [»] scaffold0169 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 18 - 201
Target Start/End: Complemental strand, 19286495 - 19286313
Alignment:
| Q |
18 |
ataacagtccatcattcttccttcgttctgatgccacagtaagggggcggttttcactgtcacgcatgtaggtgtttttggtttgtttctgtgtttggtg |
117 |
Q |
| |
|
|||||| |||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |||| ||||||||| | ||||| ||||||||||| |
|
|
| T |
19286495 |
ataacaatccatcattcttcctttgttccgatgccacagtaagggggcggttttcactgtcacgcctgtatgtgtttttgttctgtttttgtgtttggtg |
19286396 |
T |
 |
| Q |
118 |
cctgttgttgcttaagagccttttagtgctcttttagtttttggttcagctggttttttagctttctatgtatttctccttgcc |
201 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19286395 |
cctgctgttgcttaagag-cttttagtgctcttttagtttttggttcagctggttttttagctttctatgtattgctccttgcc |
19286313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0169 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold0169
Description:
Target: scaffold0169; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 132 - 186
Target Start/End: Original strand, 27801 - 27856
Alignment:
| Q |
132 |
agagccttttagtgctctttt-agtttttggttcagctggttttttagctttctat |
186 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
27801 |
agagccttttagtgctctttttagtttttggttcagctggttttttaactttctat |
27856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University