View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19176_low_40 (Length: 205)
Name: NF19176_low_40
Description: NF19176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19176_low_40 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 9e-66; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 39 - 205
Target Start/End: Complemental strand, 33830266 - 33830102
Alignment:
| Q |
39 |
tgagtaatttccttaatctaaaattgacacgtataacttctatgtagaacttgtatggtttatgttggtcgaaacatgcactttcaactttctttaatat |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33830266 |
tgagtaatttccttaatctaaaattgacacgtataacttctatgtagaacttgtatggtttatgttggtcgaaacatgcactttcaactttctttaatat |
33830167 |
T |
 |
| Q |
139 |
ttatttgttgctcatcatactctcttnnnnnnnctcatcatcacgttaatagggatttaatggattc |
205 |
Q |
| |
|
|||||||||| |||||||| ||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
33830166 |
ttatttgttgatcatcata--ctcttaaaaaaactcatcatcacgttaatagggattttatggattc |
33830102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 17 - 73
Target Start/End: Complemental strand, 33830327 - 33830271
Alignment:
| Q |
17 |
acaaatgacataggcatctctttgagtaatttccttaatctaaaattgacacgtata |
73 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||| ||| ||||||| |
|
|
| T |
33830327 |
acaaatgacataggcatctctttgagtattttccttaacctaaaaatgatacgtata |
33830271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University