View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19178_high_13 (Length: 258)

Name: NF19178_high_13
Description: NF19178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19178_high_13
NF19178_high_13
[»] chr2 (1 HSPs)
chr2 (1-242)||(21492210-21492451)


Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 21492210 - 21492451
Alignment:
1 aatatcatattggagaagagatttaccatgtcaccatgagcagcacaaaatccacaagttgactcggcccttatacacttcatacaattccaattatgat 100  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21492210 aatatcatattggagaagagatttaccatgtcaccaggagcagcacaaaatccacaagttgactcggcccttatacacttcatacaattccaattatgat 21492309  T
101 tgttcgtagctgctgtcttgaactcagggcatgtgttatttaaatgagagctttcgatgacactaaccattggtgcatgaatttcactttcacgaaaagt 200  Q
    ||||||||||||||||||||||||||||||||||||||||  ||||||||||||| | || |||||||||||||||||||||||||||||||||||||||    
21492310 tgttcgtagctgctgtcttgaactcagggcatgtgttattgtaatgagagctttcaacgagactaaccattggtgcatgaatttcactttcacgaaaagt 21492409  T
201 gacggttaaaagagtcagagaaaggacaacaccggttaaact 242  Q
    |||||||||||||||||||||||||||||||||||| |||||    
21492410 gacggttaaaagagtcagagaaaggacaacaccggtcaaact 21492451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University