View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19178_high_13 (Length: 258)
Name: NF19178_high_13
Description: NF19178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19178_high_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 21492210 - 21492451
Alignment:
| Q |
1 |
aatatcatattggagaagagatttaccatgtcaccatgagcagcacaaaatccacaagttgactcggcccttatacacttcatacaattccaattatgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21492210 |
aatatcatattggagaagagatttaccatgtcaccaggagcagcacaaaatccacaagttgactcggcccttatacacttcatacaattccaattatgat |
21492309 |
T |
|
| Q |
101 |
tgttcgtagctgctgtcttgaactcagggcatgtgttatttaaatgagagctttcgatgacactaaccattggtgcatgaatttcactttcacgaaaagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| | || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21492310 |
tgttcgtagctgctgtcttgaactcagggcatgtgttattgtaatgagagctttcaacgagactaaccattggtgcatgaatttcactttcacgaaaagt |
21492409 |
T |
|
| Q |
201 |
gacggttaaaagagtcagagaaaggacaacaccggttaaact |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21492410 |
gacggttaaaagagtcagagaaaggacaacaccggtcaaact |
21492451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University