View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19178_high_14 (Length: 253)
Name: NF19178_high_14
Description: NF19178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19178_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 131 - 234
Target Start/End: Original strand, 52725838 - 52725941
Alignment:
| Q |
131 |
agagggtaaacgagaacaaggtagagattgttagttatagatttcattattgtctttttcaccaaaattcacttggagagacatggagaccactttacct |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52725838 |
agagggtaaacgagaacaaggtagagattgttagttatagatttcattattgtctttttcaccaaaattcacttggagagaaatggagaccactttacct |
52725937 |
T |
|
| Q |
231 |
atgt |
234 |
Q |
| |
|
|||| |
|
|
| T |
52725938 |
atgt |
52725941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University