View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19178_high_17 (Length: 239)
Name: NF19178_high_17
Description: NF19178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19178_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 40436795 - 40436575
Alignment:
| Q |
1 |
tgaaaaagaaccaattatatctaatgaaagttgaatcatatgatgattgtatggatgcactactggatgcaaagcttacatgactaaactaggcttgtaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40436795 |
tgaaaaagaaccaattatatctaatgaaagttgaatcatatgatgattgtatggatgcactactggatgcaaagcttacatgactaaactaggcttgtaa |
40436696 |
T |
 |
| Q |
101 |
atagtgtattttatatatacggctatatacaaccccaaataaaaagcaatcacctatgcctatttcctcagcacagaattaacatctatattaacatgca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40436695 |
atagtgtattttatatatacggctatatacaaccccaaataaaaagcaaccatctatgcctatttcctcagcacagaattaacatctatattaacatgca |
40436596 |
T |
 |
| Q |
201 |
tttagcatgggacacttgaag |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40436595 |
tttagcatgggacacttgaag |
40436575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University