View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19178_high_18 (Length: 237)
Name: NF19178_high_18
Description: NF19178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19178_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 17 - 227
Target Start/End: Original strand, 10318087 - 10318301
Alignment:
| Q |
17 |
ggttctcccgatggagatgcaactgagtgtgccatgggcaaagggtaacaatagttgtctactcaagacttcttctgc---aataccnnnnnnngtagtg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |||||| |||||| |
|
|
| T |
10318087 |
ggttctcccgatggagatgcaactgagtgtgccatgggcaaagggtaacaatagttgtctacttaagactacttctgctgcaataccaaaaaaagtagtg |
10318186 |
T |
 |
| Q |
114 |
aaagaggatcccggttattgcttgaggaaaaagtaacaagaaactattattgcatgaggcaaaagatatttat-aaaaaagaataacacgacctccaata |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
10318187 |
aaagaggatcccggttattgcttgaggaaaaagtaacaagaaactattattgcatgaggcaaaagatatttataaaaaaagaataacatgacctccaata |
10318286 |
T |
 |
| Q |
213 |
tcatctatttcatct |
227 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
10318287 |
tcatctatttcatct |
10318301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University