View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19178_high_20 (Length: 220)
Name: NF19178_high_20
Description: NF19178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19178_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 6 - 203
Target Start/End: Complemental strand, 25732363 - 25732166
Alignment:
| Q |
6 |
tgtcgaagaaaatggggaaggaagcaccgtcgagaagagcgatgactttagggtctggtgctatgaaaccacctggtggcatgttgagtttgaggacagt |
105 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25732363 |
tgtcgaagaggatggggaaggaagcaccgtcgagaagagcgatgacttttgggtctggagcgatgaaaccacctggtggcatgttgagtttgaggacagt |
25732264 |
T |
 |
| Q |
106 |
ggaattgtatttttcgattctggtttggaagtatttgtcacgtccttggttgtagaagtagtcgtgtctgtcatggaggggtccgatgatgggaagac |
203 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25732263 |
ggagttgtatttttcgattctggtttggaagtatttgtcacgtccttggttgtagaagtagtcatgtctgtcatggaggggtccgatgatgggaagac |
25732166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 76 - 173
Target Start/End: Complemental strand, 12490668 - 12490571
Alignment:
| Q |
76 |
acctggtggcatgttgagtttgaggacagtggaattgtatttttcgattctggtttggaagtatttgtcacgtccttggttgtagaagtagtcgtgtc |
173 |
Q |
| |
|
|||||||||||||||| | ||| || || || |||||||||| |||||| ||| |||| ||||||| | |||||||||||||||||||||||||| |
|
|
| T |
12490668 |
acctggtggcatgttggttctgaagattgttgagttgtatttttggattcttgttgagaagaatttgtctcttccttggttgtagaagtagtcgtgtc |
12490571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University