View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19178_high_20 (Length: 220)

Name: NF19178_high_20
Description: NF19178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19178_high_20
NF19178_high_20
[»] chr4 (1 HSPs)
chr4 (6-203)||(25732166-25732363)
[»] chr1 (1 HSPs)
chr1 (76-173)||(12490571-12490668)


Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 6 - 203
Target Start/End: Complemental strand, 25732363 - 25732166
Alignment:
6 tgtcgaagaaaatggggaaggaagcaccgtcgagaagagcgatgactttagggtctggtgctatgaaaccacctggtggcatgttgagtttgaggacagt 105  Q
    |||||||||  |||||||||||||||||||||||||||||||||||||| |||||||| || ||||||||||||||||||||||||||||||||||||||    
25732363 tgtcgaagaggatggggaaggaagcaccgtcgagaagagcgatgacttttgggtctggagcgatgaaaccacctggtggcatgttgagtttgaggacagt 25732264  T
106 ggaattgtatttttcgattctggtttggaagtatttgtcacgtccttggttgtagaagtagtcgtgtctgtcatggaggggtccgatgatgggaagac 203  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
25732263 ggagttgtatttttcgattctggtttggaagtatttgtcacgtccttggttgtagaagtagtcatgtctgtcatggaggggtccgatgatgggaagac 25732166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 76 - 173
Target Start/End: Complemental strand, 12490668 - 12490571
Alignment:
76 acctggtggcatgttgagtttgaggacagtggaattgtatttttcgattctggtttggaagtatttgtcacgtccttggttgtagaagtagtcgtgtc 173  Q
    ||||||||||||||||  | ||| ||  || || |||||||||| |||||| |||  |||| ||||||| | ||||||||||||||||||||||||||    
12490668 acctggtggcatgttggttctgaagattgttgagttgtatttttggattcttgttgagaagaatttgtctcttccttggttgtagaagtagtcgtgtc 12490571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University