View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19178_low_15 (Length: 253)

Name: NF19178_low_15
Description: NF19178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19178_low_15
NF19178_low_15
[»] chr4 (1 HSPs)
chr4 (131-234)||(52725838-52725941)


Alignment Details
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 131 - 234
Target Start/End: Original strand, 52725838 - 52725941
Alignment:
131 agagggtaaacgagaacaaggtagagattgttagttatagatttcattattgtctttttcaccaaaattcacttggagagacatggagaccactttacct 230  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
52725838 agagggtaaacgagaacaaggtagagattgttagttatagatttcattattgtctttttcaccaaaattcacttggagagaaatggagaccactttacct 52725937  T
231 atgt 234  Q
    ||||    
52725938 atgt 52725941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University