View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19179_high_24 (Length: 255)

Name: NF19179_high_24
Description: NF19179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19179_high_24
NF19179_high_24
[»] chr3 (1 HSPs)
chr3 (102-136)||(25338144-25338178)
[»] chr5 (1 HSPs)
chr5 (227-255)||(31572271-31572299)


Alignment Details
Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 136
Target Start/End: Original strand, 25338144 - 25338178
Alignment:
102 aaattggattgaagtagaaaatctccacttgagag 136  Q
    |||||||||||||||||||||||||||||||||||    
25338144 aaattggattgaagtagaaaatctccacttgagag 25338178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 227 - 255
Target Start/End: Complemental strand, 31572299 - 31572271
Alignment:
227 attttcaataattggaatgcatgaagttg 255  Q
    |||||||||||||||||||||||||||||    
31572299 attttcaataattggaatgcatgaagttg 31572271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University