View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19179_high_24 (Length: 255)
Name: NF19179_high_24
Description: NF19179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19179_high_24 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 136
Target Start/End: Original strand, 25338144 - 25338178
Alignment:
| Q |
102 |
aaattggattgaagtagaaaatctccacttgagag |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
25338144 |
aaattggattgaagtagaaaatctccacttgagag |
25338178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 227 - 255
Target Start/End: Complemental strand, 31572299 - 31572271
Alignment:
| Q |
227 |
attttcaataattggaatgcatgaagttg |
255 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31572299 |
attttcaataattggaatgcatgaagttg |
31572271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University