View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19179_high_26 (Length: 238)
Name: NF19179_high_26
Description: NF19179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19179_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 17328180 - 17327960
Alignment:
| Q |
1 |
tttctcaaccttcaaccactttcactaccaggcctattcatcacaaccatcctaaacacaataatcatcctcacaataagccttattggaagaatcttag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17328180 |
tttctcaaccttcaaccactttcactaccaggcttattcatcacaaccatcctaaacacaataatcatcctcacaataagccttattggaagaatcttag |
17328081 |
T |
 |
| Q |
101 |
gtggtgctagtttcaacccttcatccacaatttccttctatacattaggactaagaccagattcatctcttctatcttttgccataaggtttcctgctca |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17328080 |
gtggtgctagttttaacccttcatccacaatttccttctacacattaggactaagaccagattcatctcttctatcttttgccataaggtttcctgctca |
17327981 |
T |
 |
| Q |
201 |
agcaataggtggagcaattgg |
221 |
Q |
| |
|
||||||||||||||| ||||| |
|
|
| T |
17327980 |
agcaataggtggagctattgg |
17327960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University