View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19179_low_21 (Length: 280)

Name: NF19179_low_21
Description: NF19179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19179_low_21
NF19179_low_21
[»] chr5 (2 HSPs)
chr5 (17-194)||(9185882-9186042)
chr5 (216-270)||(9185591-9185645)


Alignment Details
Target: chr5 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 17 - 194
Target Start/End: Complemental strand, 9186042 - 9185882
Alignment:
17 aaaatcaactttacaagtgaacgatgaaattctttaaaattctttttacactagaaatcttttcggtatgagatttagaatatgacgacttctggtggca 116  Q
    |||||||||||   |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||                 |||    
9186042 aaaatcaacttgtaaagtgaacgatgaaattctttaaaattctttttacattagaaatcttttcggtatgagatttagaa-----------------gca 9185960  T
117 cttggatagaatttaagaaaggggcaaagtcaattttttatgtgtgctatactatgtgtttttagtccacaccaccat 194  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
9185959 cttggatagaatttaagaaaggggcaaagtcaattttttatgtgtgctatactatgtgtttttaatccacaccaccat 9185882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 216 - 270
Target Start/End: Complemental strand, 9185645 - 9185591
Alignment:
216 ggttagatgttattttatgtaagccagtatcaataatacttgcttgctgcctttg 270  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
9185645 ggttagatgttattttatgtaagccagtatcaatattacttgcttgctgcctttg 9185591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University