View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19180_high_3 (Length: 268)
Name: NF19180_high_3
Description: NF19180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19180_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 42159514 - 42159248
Alignment:
| Q |
1 |
ccacatagcaacacgttcagttcaatgaaagcaacaaacccaaggaacagctagcattatatatttcctctctaatacgacacattattctacttatagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42159514 |
ccacatagcaacacgttcagttcaatgaaagcaacaaacccaaggaacaactagcattatatatttcctctctaatacgacacattcttctacttatagg |
42159415 |
T |
 |
| Q |
101 |
aaactttagtcgctatagacgaagcactttaaaaatcatttcagaaagaaaaa-------------actaatctactatatatagtaagaagatatatat |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42159414 |
aaactttagtcgctatagacgaagcactttaaaaatcatttcagaaagaaaaaaaattatatacatactaatctactatatatagtaagaagatatatat |
42159315 |
T |
 |
| Q |
188 |
gttatctgtttgagaaactagtttgtaaaatggcatcggtattggcaggggatgaggtgacaatatc |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42159314 |
gttatctgtttgagaaactagtttgtaaaatggcatcggtattggcaggggatgaggtgacaatatc |
42159248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 192 - 254
Target Start/End: Complemental strand, 42180284 - 42180222
Alignment:
| Q |
192 |
tctgtttgagaaactagtttgtaaaatggcatcggtattggcaggggatgaggtgacaatatc |
254 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42180284 |
tctgtttgagaaactagttagtaaaatggcatccgtattggcaggggatgaggtgacaatatc |
42180222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 197 - 254
Target Start/End: Complemental strand, 42146992 - 42146935
Alignment:
| Q |
197 |
ttgagaaactagtttgtaaaatggcatcggtattggcaggggatgaggtgacaatatc |
254 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
42146992 |
ttgagaaattagttagtaaaatggcatcggtaatggcaagggatgaggtgacaatatc |
42146935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University