View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19181_low_1 (Length: 387)
Name: NF19181_low_1
Description: NF19181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19181_low_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 300; Significance: 1e-168; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 1 - 374
Target Start/End: Complemental strand, 49009686 - 49009332
Alignment:
| Q |
1 |
cttatttgttggcctcctttgtttttacacgctttcaagagttctcttattgttccttagagccccagaagcaggaggcaaaattgcatatgtttaacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
49009686 |
cttatttgttggcctcctttgtttttacacgctttcaagagttctcttattgttccttagagccctagaagcaggaggcaaaattgaatatgtttaacaa |
49009587 |
T |
 |
| Q |
101 |
gggacatctatttctgtatatgtagagaagaaaattgttgtgcatgtcatttagcaaatcatgttttctctctttctggcttttctttcttggtgggatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49009586 |
gggacatctatttctgtatatgtagagaagaaaattgttgtgcatgtcatttagcaaatcatgatttctctctttctggcttttcttt------------ |
49009499 |
T |
 |
| Q |
201 |
agttacaccattatattgagaaatatctaatgatgccaaaagagagttgaagaaggttgtaatcactatgaggatctccaagatgctcaatgacaacaag |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49009498 |
-------ccattatattgagaaatatctaatgatgccaaaagagagttgaagaaggttgtaatcactatgaggatctccaagatgctcaatgacaacaag |
49009406 |
T |
 |
| Q |
301 |
agggtgtaattatcataagtaaagctaagatattcaaatggatatggaaggaaattttgctattttgtttattt |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49009405 |
agggtgtaattatcataagtaaagctaagatattcaaatggatatggaaggaaattttgctattttgtttattt |
49009332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University