View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19182_high_10 (Length: 293)
Name: NF19182_high_10
Description: NF19182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19182_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 3 - 277
Target Start/End: Complemental strand, 46770009 - 46769736
Alignment:
| Q |
3 |
cgtgtatctcatgcgcgcaactatatagactaatccatcgagttgggttgcactgcaatagacggaaaagttctctctnnnnnnntttaacgatctccag |
102 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| | ||||||||||||||||| ||||||||||||||| |
|
|
| T |
46770009 |
cgtgtatctcatgcgcgcaactatttagactaatccattgagttgggttgcactgcaaaaaacggaaaagttctctctaaaaaaatttaacgatctccag |
46769910 |
T |
 |
| Q |
103 |
tttaattgattcgaacacatgttctccggcaaaacttgattcgaatttattgatctcgaatttaattgagagagatcctttagcatctcatctaaaagca |
202 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46769909 |
tttaattgattcgaactcatgttctccggcaaaacttgattcgaatttat-gatctcgagtttaattgagagagatcctttagcatctcatctaaaagca |
46769811 |
T |
 |
| Q |
203 |
tattcaattacaagtttataaggaacacgaacttgattattttataatattaagtggcttccacaatgtcatatc |
277 |
Q |
| |
|
| |||||||||||||||||||||||||| || |||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46769810 |
tcttcaattacaagtttataaggaacacaaatttgattcttttataatattaagtggctcccacaatgtcatatc |
46769736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University