View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19182_high_8 (Length: 301)
Name: NF19182_high_8
Description: NF19182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19182_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 26 - 282
Target Start/End: Complemental strand, 43639881 - 43639625
Alignment:
| Q |
26 |
gaccctcaaggagtgaaagaaggtgttaagggtttagtagaaggtgggtgtcctccaagttttgtaatcattgatgatggttggcaaaatttttgtcgtg |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43639881 |
gaccctcaaggagtgaaagaaggtgttaagggtttagtagaaggtgggtgtcctccaagttttgtaatcattgatgatggttggcaaaatttttgtcgtg |
43639782 |
T |
|
| Q |
126 |
atgatgaagattttttgaacggtggtgattgtttaagtttgaattgttctatacctggtgaacaaatgttgggaaggttaataagttttgaagaaaataa |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43639781 |
atgatgaagattttttgaacggtggtgattgtttaagtttgaattgttctatacctggcgaacaaatgttgggaaggttaataagttttgaagaaaataa |
43639682 |
T |
|
| Q |
226 |
aaaatttaaggaatatgatgaatctttaggtatgggtgggtttgtgagggatttaaa |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43639681 |
aaaatttaaggaatatgatgaatctttaggtatgggtgggtttgtgagggatttaaa |
43639625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University