View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19182_low_14 (Length: 241)
Name: NF19182_low_14
Description: NF19182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19182_low_14 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 94 - 241
Target Start/End: Complemental strand, 2836654 - 2836503
Alignment:
| Q |
94 |
tttaaaaatgaaaaggccacaatttcacacaagaatccctcaagataccgaacccccattttaagtcttttagcaat----gaattctacaattacaaag |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2836654 |
tttaaaaatgaaaaggccacaatttcacacaagaatccctcaagataccgaatccccattttaagtcttttagcaatgaatgaattctacaattacaaag |
2836555 |
T |
|
| Q |
190 |
tatttgagctcagattttgtgtagacgaatcaccttttgatctatgaaactg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2836554 |
tatttgagctcagattttgtgtagacgaatcaccttttgatctatgaaactg |
2836503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 17 - 98
Target Start/End: Complemental strand, 2836822 - 2836741
Alignment:
| Q |
17 |
aaaggtaacaaaaattgaacaaatatccgatgattcttgcacatcaggagagaatgagttcttttatgtgaaattcttttaa |
98 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2836822 |
aaaggtaacaaaaattgaacatatatccgatgattcttgcacatcaagagagaatgagttcttttaagtgaaattcttttaa |
2836741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University