View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19182_low_15 (Length: 239)
Name: NF19182_low_15
Description: NF19182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19182_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 52250777 - 52250584
Alignment:
| Q |
1 |
atttgtgagatgagaaatgagaagatggatcctggatggaattttgaattgtttgatgatgaaatggtggctgagaatggtgcgagatctgttgctgctg |
100 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||| ||||||||||||| | ||||||||||||||||| ||||||||||||| || |||||||||||||| |
|
|
| T |
52250777 |
atttgtgaaatgaggaatgagaagatggatcctgcatggaattttgaactttttgatgatgaaatggttgctgagaatggtgtgaaatctgttgctgctg |
52250678 |
T |
 |
| Q |
101 |
ttcaagctagggataatattgctcatgacttgttgcatcgtggccgtgctggcaatacttttctatagg----tttatgttttctgttatgtca |
190 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| |||| ||||||||||||| |||| | ||||||||||||||||||||| |
|
|
| T |
52250677 |
ctcaagctagggataatattgctcatgatttgttgcatcgtggtcgtgttggcaatacttttttataagtttttttatgttttctgttatgtca |
52250584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 52262419 - 52262300
Alignment:
| Q |
1 |
atttgtgagatgagaaatgagaagatggatcctggatggaattttgaattgtttgatgatgaaatggtggctgagaatggtgcgagatctgttgctgctg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52262419 |
atttgtgagatgagaaatgagaagatggatc-tggatggaattttgaattgtttgatgatgaaatggtggctgagaatggtgcgagatctgttgctgctg |
52262321 |
T |
 |
| Q |
101 |
ttcaagctagggataatattg |
121 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
52262320 |
ttcaagctagggataatattg |
52262300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 177 - 221
Target Start/End: Complemental strand, 52262277 - 52262233
Alignment:
| Q |
177 |
tttctgttatgtcaaatgatttcaatattttagctatgacttatt |
221 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52262277 |
tttctattatgtcaaatgatttcaatattttagctatgacttatt |
52262233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University