View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19182_low_4 (Length: 369)
Name: NF19182_low_4
Description: NF19182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19182_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 3e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 141 - 356
Target Start/End: Complemental strand, 3707615 - 3707394
Alignment:
| Q |
141 |
ccggattatgtaatctaaaaatctgtagggcgtgcgaaaaaccagaaggtagggatagaaaccatcaaagtattatcctatgatttttgcaggtatagac |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3707615 |
ccggattatgtaatctaaaaatctgtagggcgtgcgaaaaaccaataggtagggatagaaaccatcaaagtattatcctatgatttttgcaggtatagac |
3707516 |
T |
|
| Q |
241 |
aaagaagctttaagagtgtattcatttgaagcccatcagaccannnnnnngctttgggagccgaaaccct-------ttgtagagtggtaattgctcatt |
333 |
Q |
| |
|
|||||| | |||||||||||||||||||||||| | | ||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3707515 |
aaagaaac-ttaagagtgtattcatttgaagcctaccggaccatttttttgctttgggagccgaaacccttcaattgttgtagagtggtaattgctcatt |
3707417 |
T |
|
| Q |
334 |
tatacttccaacgattcatctca |
356 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
3707416 |
tatacttccaacgattcttctca |
3707394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University