View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19183_high_9 (Length: 263)
Name: NF19183_high_9
Description: NF19183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19183_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 41425790 - 41425538
Alignment:
| Q |
1 |
gaataaccccagacccaatccctatagacttcactacaagggcacatgttaggacattgcgccgtcaatggaccaaatcatatccctctagtagccaatc |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41425790 |
gaataatcccagacccaatccctatagacttcactacaagggcacaggttaggacgctgcgccgtcaatggaccaaatcatatccctctagtagccaatc |
41425691 |
T |
|
| Q |
101 |
actgcatgatcatcgtcagacagtgatccactaatt-gcgttgataatctctcagtaatgcaatgagaaaggtagacaatcaaatataataaatccatca |
199 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41425690 |
actgcatgatcatcgtcag----tgatccactaatttgctttgataatctctcagtaatgcaatgagaaaggtagacaatcaaatataataaatccatca |
41425595 |
T |
|
| Q |
200 |
ttctactcgacgtcacaatgtttgcagatacatcaccaactctggccgttatctctg |
256 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| | |||||||||||| |
|
|
| T |
41425594 |
ttctactcgacgtcacaatgtttgcagatgcatcaccaactccgaccgttatctctg |
41425538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University