View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19184_high_13 (Length: 250)
Name: NF19184_high_13
Description: NF19184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19184_high_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 21437934 - 21437696
Alignment:
| Q |
1 |
tatcttcccttgttgaggattctagaaggtttgatatacttctgccggtgattttcttcttttttgaacaactgcatttgttatctttacacttgatctc |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
21437934 |
tatctccccttgttgaggattctagaaggtttgatatacttttgccggtgattttcttcttttgtgaacaactgcatttgttatctttacacttgatctc |
21437835 |
T |
|
| Q |
101 |
taggtaaggtgtttttgcatgccttggtgaacttggatttctgcacaacaatttctaagaaatgttgatgcaatatgcacaagttttcaagttcctctaa |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21437834 |
taggtaaggtttttttgcatgccttggtgaacttggatttctgcacaacaatttctaagaaatgttgatgcaatatgcacaagttttcaagttcctctaa |
21437735 |
T |
|
| Q |
201 |
ggtcatctgatggatatgaccgagattcatggctttcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21437734 |
ggtcatctgatggatatgaccgagattcatggctttcat |
21437696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 133 - 233
Target Start/End: Complemental strand, 12352900 - 12352800
Alignment:
| Q |
133 |
ttggatttctgcacaacaatttctaagaaatgttgatgcaatatgcacaagttttcaagttcctctaaggtcatctgatggatatgaccgagattcatgg |
232 |
Q |
| |
|
|||||||||||| ||| || ||| ||||||||||||||| | ||||||| ||||| ||| |||| || || |||||||| || ||||| ||| |||||| |
|
|
| T |
12352900 |
ttggatttctgctcaatgatctctgagaaatgttgatgcagtctgcacaatttttcgagtgcctccaaagttatctgatgaatttgaccaagactcatgg |
12352801 |
T |
|
| Q |
233 |
c |
233 |
Q |
| |
|
| |
|
|
| T |
12352800 |
c |
12352800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University