View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19184_low_11 (Length: 272)
Name: NF19184_low_11
Description: NF19184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19184_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 19 - 185
Target Start/End: Original strand, 50748404 - 50748570
Alignment:
| Q |
19 |
cctgctactatttttggtagttttgatagtcaaaatcctggtttgatgaaaattccaaatgttgtttttggatctgagattaaagatgagcttttggaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50748404 |
cctgctactatttttggtagttttgatagtcaaaatcctggtttgatgaaaattccaaatgttgtttttggatctgagattaaagatgagcttttggaaa |
50748503 |
T |
|
| Q |
119 |
aggcttttggacttaattctaaggagctttctaagttaaagaagaggttttctccaacctaaatttc |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
50748504 |
aggcttttggacttaattctaaggagctttctaagttaaagaagaggttttctccaagctaaatttc |
50748570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University