View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19184_low_15 (Length: 251)
Name: NF19184_low_15
Description: NF19184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19184_low_15 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 44 - 251
Target Start/End: Original strand, 13590051 - 13590258
Alignment:
| Q |
44 |
agaaaagaaaatacatataatattttctttgcattttttggataaatatgtatttatgtatgtttctagaacttgctattcgatatgtttctttttctgt |
143 |
Q |
| |
|
|||||||||||||||| |||| | ||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13590051 |
agaaaagaaaatacatttaatctcttctttgcaatttttggataaatatgcatttatgtatgtttctagaacttgctattcgatatgtttctttctctgt |
13590150 |
T |
|
| Q |
144 |
ccctatatcatctgccacctctattattatctttccnnnnnnnnaatgccatttatatcacacaaaaaccttctttctctttcctcaactttctagtcct |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13590151 |
ccctatatcatctgccacctctattattatctttccttttttttaatgccatttatatcacacaaaaaccttctttctctttcctcaactttctagtcct |
13590250 |
T |
|
| Q |
244 |
ctctcatt |
251 |
Q |
| |
|
|||||||| |
|
|
| T |
13590251 |
ctctcatt |
13590258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 17 - 46
Target Start/End: Original strand, 13589913 - 13589942
Alignment:
| Q |
17 |
taaacactccctccaaccttattaattaga |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13589913 |
taaacactccctccaaccttattaattaga |
13589942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University