View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19185_high_20 (Length: 296)
Name: NF19185_high_20
Description: NF19185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19185_high_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 146 - 281
Target Start/End: Complemental strand, 7538500 - 7538365
Alignment:
| Q |
146 |
tcactcaccataaccaaatatggcagagataatagtggcagctaacacacaagcacaagcatgcttgttgagatggtttacatccccacaagtgttttcc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
7538500 |
tcactcaccataaccaaatatggcagagataatagtggcagctaacacacaagcacaagcatgcttgttgagatggtttacatccccacacgtgctttcc |
7538401 |
T |
|
| Q |
246 |
atggatgatacttggctgtgcccatttgtttctttt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
7538400 |
atggatgatacttggctgtgcccatttgtttctttt |
7538365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 19 - 97
Target Start/End: Complemental strand, 7538625 - 7538549
Alignment:
| Q |
19 |
ataaataattctcctgaatgatttctataaacctgcctgaattcattcctctccaaatgcacaactattatgagacagt |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7538625 |
ataaataattctcctgaatgatttctataaacctgcttgaattcattc--ctccaaatgcacaactattatgagacagt |
7538549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University