View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19185_high_29 (Length: 243)

Name: NF19185_high_29
Description: NF19185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19185_high_29
NF19185_high_29
[»] chr1 (1 HSPs)
chr1 (2-142)||(12487785-12487925)


Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 2 - 142
Target Start/End: Complemental strand, 12487925 - 12487785
Alignment:
2 taattaataacttttatctaaaagtttatagttttgagataaagggatcgagtactataatagacatgattgaattggtcccttccctcatgtcatgtgt 101  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12487925 taattaataacttttatctaaaagtttatagttttgagataaagggatcgagtactataatagacatgattgaattggtcccttccctcatgtcatgtgt 12487826  T
102 aaattcagcacagtttgcaaggtggggaaaatttgttactt 142  Q
     ||||||| ||||||||||||||||||||||||||||||||    
12487825 gaattcagtacagtttgcaaggtggggaaaatttgttactt 12487785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University