View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19185_high_31 (Length: 238)
Name: NF19185_high_31
Description: NF19185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19185_high_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 171 - 221
Target Start/End: Original strand, 5976259 - 5976309
Alignment:
| Q |
171 |
ttgtgaagaggaatctattataaagagaagcgattttggtgtattcacgaa |
221 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5976259 |
ttgtgaagaggaatcgattataaagagaagcgattttggtgtattcacgaa |
5976309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 150 - 207
Target Start/End: Complemental strand, 37486100 - 37486043
Alignment:
| Q |
150 |
tttctcattcttgttcagttgttgtgaagaggaatctattataaagagaagcgatttt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| | |||||||||||| |
|
|
| T |
37486100 |
tttctcattcttgttcagttgttgtgaagaggaatcgattatgagaagaagcgatttt |
37486043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 55
Target Start/End: Original strand, 54428864 - 54428898
Alignment:
| Q |
21 |
ggtacacctcactttatgagtgtacagtagaagtt |
55 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
54428864 |
ggtacacctcattttatgagtgtacagtagaagtt |
54428898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 21 - 58
Target Start/End: Original strand, 23456827 - 23456864
Alignment:
| Q |
21 |
ggtacacctcactttatgagtgtacagtagaagtttcc |
58 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
23456827 |
ggtacacctcactttgtgagtgtaccgtagaagtttcc |
23456864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 21 - 57
Target Start/End: Complemental strand, 37127841 - 37127805
Alignment:
| Q |
21 |
ggtacacctcactttatgagtgtacagtagaagtttc |
57 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
37127841 |
ggtacacctcattttatgagtgtaccgtagaagtttc |
37127805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 21 - 59
Target Start/End: Original strand, 15231356 - 15231394
Alignment:
| Q |
21 |
ggtacacctcactttatgagtgtacagtagaagtttcct |
59 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15231356 |
ggtacacctcactttatgagtgtaccgtagaagtttcct |
15231394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 55
Target Start/End: Complemental strand, 29265626 - 29265592
Alignment:
| Q |
21 |
ggtacacctcactttatgagtgtacagtagaagtt |
55 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29265626 |
ggtacacctcactttgtgagtgtacagtagaagtt |
29265592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 23 - 58
Target Start/End: Original strand, 31999096 - 31999131
Alignment:
| Q |
23 |
tacacctcactttatgagtgtacagtagaagtttcc |
58 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31999096 |
tacacctcactttatgagtgtaccgtagaagtttcc |
31999131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 55
Target Start/End: Original strand, 38261172 - 38261206
Alignment:
| Q |
21 |
ggtacacctcactttatgagtgtacagtagaagtt |
55 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38261172 |
ggtacacctcactttatgagtgtaccgtagaagtt |
38261206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University