View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19185_high_34 (Length: 236)
Name: NF19185_high_34
Description: NF19185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19185_high_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 130
Target Start/End: Complemental strand, 331799 - 331670
Alignment:
| Q |
1 |
tgagtctttaatttgtaaaggttaaagtgcaattttatttttgtgatgagttaaaataaaaatatgaatgaataactctaatttgaattcaacaccgaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
331799 |
tgagtctttaatttgtaaaggttaaagtgcaattttatttttgtgatgagttaaaataaaaatatgaatgaataactctaatttgaattcaacaccgaca |
331700 |
T |
|
| Q |
101 |
catttactatgaggacatcgttaaagagtt |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
331699 |
catttactatgaggacatcgttaaagagtt |
331670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 331672 - 331632
Alignment:
| Q |
182 |
gtttaacgaaggatccaaatgctgacgtgaaggatgattat |
222 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
331672 |
gtttaacgaaggatccaaacgttgacgtgaaggatgattat |
331632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University