View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19185_low_24 (Length: 267)

Name: NF19185_low_24
Description: NF19185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19185_low_24
NF19185_low_24
[»] chr2 (1 HSPs)
chr2 (18-160)||(7422863-7423004)


Alignment Details
Target: chr2 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 18 - 160
Target Start/End: Complemental strand, 7423004 - 7422863
Alignment:
18 tggtggatatgcatttgatttttggatccttgcaaacacccaaggcccactgttctacccttacgtaatgattgaatgatggtgacggtggtgatggcga 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
7423004 tggtggatatgcatttgatttttggatccttgcaaacacccaaggcccactgttctaccctt-cgtaatgattgaatgatggtgacggtggtgatggcga 7422906  T
118 tggcgatggtgctagtgctgctaatattgccaatgtcgaagtc 160  Q
    ||| |||||||||||||||||||||||||||||||||||||||    
7422905 tggtgatggtgctagtgctgctaatattgccaatgtcgaagtc 7422863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University